Mutations, mutogens, types of mutations, causes of mutations, meaning of mutations
Mutation (lat. mutatio - change) is a persistent (that is, one that can be inherited by the descendants of a given cell or organism) transformation of the genotype that occurs under the influence of the external or internal environment.
The term was proposed by Hugo de Vries.
The process of mutations is called mutagenesis.
Causes of mutations
Mutations are divided into spontaneous and induced.
Spontaneous mutations occur spontaneously throughout the life of an organism under normal conditions. environment with a frequency of about - per nucleotide per cell generation.
Induced mutations are heritable changes in the genome that arise as a result of certain mutagenic effects in artificial (experimental) conditions or under adverse environmental influences.
Mutations appear constantly during processes occurring in a living cell. The main processes leading to the occurrence of mutations are DNA replication, DNA repair disorders, transcription and genetic recombination.
Relationship between mutations and DNA replication
Many spontaneous chemical changes in nucleotides lead to mutations that occur during replication. For example, due to the deamination of cytosine opposite it, uracil can be included in the DNA chain (formation pair U-G instead of the canonical pair C-G). During DNA replication opposite uracil, adenine is included in the new chain, a U-A pair is formed, and during the next replication it is replaced by a T-A pair, that is, a transition occurs (a point replacement of a pyrimidine with another pyrimidine or a purine with another purine).
Relationship between mutations and DNA recombination
Of the processes associated with recombination, unequal crossing over most often leads to mutations. It usually occurs in cases where there are several duplicated copies of the original gene on the chromosome that have retained a similar nucleotide sequence. As a result of unequal crossing over, duplication occurs in one of the recombinant chromosomes, and deletion occurs in the other.
Relationship between mutations and DNA repair
Spontaneous DNA damage is quite common and occurs in every cell. To eliminate the consequences of such damage, there are special repair mechanisms (for example, an erroneous section of DNA is cut out and the original one is restored at this place). Mutations occur only when the repair mechanism for some reason does not work or cannot cope with the elimination of damage. Mutations that occur in genes encoding proteins responsible for repair can lead to a multiple increase (mutator effect) or decrease (antimutator effect) in the frequency of mutation of other genes. Thus, mutations in the genes of many enzymes of the excision repair system lead to a sharp increase in the frequency of somatic mutations in humans, and this, in turn, leads to the development of xeroderma pigmentosum and malignant tumors covers. Mutations can appear not only during replication, but also during repair - excision repair or post-replicative repair.
Mutagenesis models
Currently, there are several approaches to explain the nature and mechanisms of mutation formation. Currently, the polymerase model of mutagenesis is generally accepted. It is based on the idea that the only reason for the formation of mutations is random errors in DNA polymerases. In the tautomeric model of mutagenesis proposed by Watson and Crick, the idea was first put forward that mutagenesis is based on the ability of DNA bases to be in different tautomeric forms. The process of mutation formation is considered as a purely physical and chemical phenomenon. The polymerase-tautomeric model of ultraviolet mutagenesis is based on the idea that during the formation of cis-syn cyclobutane pyrimidine dimers, the tautomeric state of their constituent bases can change. Error-prone and SOS synthesis of DNA containing cis-syn cyclobutane pyrimidine dimers is studied. There are other models.
Polymerase model of mutagenesis
In the polymerase model of mutagenesis, it is believed that the only reason for the formation of mutations is sporadic errors in DNA polymerases. The polymerase model of ultraviolet mutagenesis was first proposed by Bresler. He suggested that mutations appear as a result of the fact that DNA polymerases opposite photodimers sometimes insert non-complementary nucleotides. Currently, this point of view is generally accepted. There is a well-known rule (A rule), according to which DNA polymerase most often inserts adenines opposite damaged areas. The polymerase model of mutagenesis explains the nature of targeted base substitution mutations.
Tautomeric model of mutagenesis
Watson and Crick suggested that spontaneous mutagenesis is based on the ability of DNA bases to transform, under certain conditions, into non-canonical tautomeric forms, affecting the nature of base pairing. This hypothesis attracted attention and was actively developed. Rare tautomeric forms of cytosine discovered in base crystals nucleic acids irradiated with ultraviolet light. The results of numerous experimental and theoretical research clearly indicate that DNA bases can transition from canonical tautomeric forms to rare tautomeric states. Much work has been done on the study of rare tautomeric forms of DNA bases. Using quantum mechanical calculations and the Monte Carlo method, it was shown that the tautomeric equilibrium in cytosine-containing dimers and in cytosine hydrate is shifted towards their imino forms both in the gas phase and in aqueous solution. Ultraviolet mutagenesis is explained on this basis. In the guanine-cytosine pair, only one rare tautomeric state will be stable, in which the hydrogen atoms of the first two hydrogen bonds responsible for base pairing simultaneously change their positions. And since this changes the positions of the hydrogen atoms involved in Watson-Crick base pairing, the consequence may be the formation of base substitution mutations, transitions from cytosine to thymine, or the formation of homologous transversions from cytosine to guanine. The participation of rare tautomeric forms in mutagenesis has been discussed repeatedly.
Mutation classifications
There are several classifications of mutations based on various criteria. Möller proposed dividing mutations according to the nature of the change in the functioning of the gene into hypomorphic (the modified alleles act in the same direction as the wild-type alleles; only less protein product is synthesized), amorphous (the mutation looks like total loss gene functions, for example, the white mutation in Drosophila), antimorphic (the mutant trait changes, for example, the color of the corn grain changes from purple to brown) and neomorphic.
In modern educational literature A more formal classification is also used, based on the nature of changes in the structure of individual genes, chromosomes and the genome as a whole. Within this classification, the following types of mutations are distinguished:
genomic;
chromosomal;
genetic
Genomic: - polyploidization (the formation of organisms or cells whose genome is represented by more than two (3n, 4n, 6n, etc.) sets of chromosomes) and aneuploidy (heteroploidy) - a change in the number of chromosomes that is not multiple haploid set(see Inge-Vechtomov, 1989). Depending on the origin of chromosome sets among polyploids, allopolyploids are distinguished, which have sets of chromosomes obtained by hybridization from different types, and autopolyploids, in which the number of chromosome sets of their own genome increases by a multiple of n.
With chromosomal mutations, major rearrangements in the structure of individual chromosomes occur. In this case, there is a loss (deletion) or doubling of part of the genetic material of one or more chromosomes, a change in the orientation of chromosome segments in individual chromosomes (inversion), as well as the transfer of part of the genetic material from one chromosome to another (translocation) ( extreme case- the union of whole chromosomes, the so-called. Robertsonian translocation, which is a transitional variant from a chromosomal mutation to a genomic one).
At the gene level, changes in the primary DNA structure of genes under the influence of mutations are less significant than with chromosomal mutations, but gene mutations are more common. As a result of gene mutations, substitutions, deletions and insertions of one or more nucleotides, translocations, duplications and inversions of various parts of the gene occur. In the case when only one nucleotide changes under the influence of a mutation, they speak of point mutations.
Point mutation
A point mutation, or single base substitution, is a type of mutation in DNA or RNA that is characterized by the replacement of one nitrogenous base with another. The term also applies to pairwise nucleotide substitutions. The term point mutation also includes insertions and deletions of one or more nucleotides. There are several types of point mutations.
Base substitution point mutations. Since DNA contains only two types of nitrogenous bases - purines and pyrimidines, all point mutations with base substitutions are divided into two classes: transitions and transversions. Transition is a base substitution mutation, when one purine base is replaced by another purine base (adenine to guanine or vice versa), or a pyrimidine base by another pyrimidine base (thymine to cytosine or vice versa. Transversion is a base substitution mutation, when one purine base is replaced to a pyrimidine base or vice versa). Transitions occur more often than transversions.
Reading frameshift point mutations. They are divided into deletions and insertions. Deletions are frameshift mutations where one or more nucleotides are lost in a DNA molecule. An insertion is a reading frameshift mutation when one or more nucleotides are inserted into a DNA molecule.
Complex mutations also occur. These are changes in DNA when one section of it is replaced by a section of a different length and a different nucleotide composition.
Point mutations can appear opposite damage to the DNA molecule that can stop DNA synthesis. For example, opposite cyclobutane pyrimidine dimers. Such mutations are called target mutations (from the word “target”). Cyclobutane pyrimidine dimers cause both targeted base substitution mutations and targeted frameshift mutations.
Sometimes point mutations occur in so-called undamaged regions of DNA, often in a small vicinity of photodimers. Such mutations are called untargeted base substitution mutations or untargeted frameshift mutations.
Point mutations do not always form immediately after exposure to a mutagen. Sometimes they appear after dozens of replication cycles. This phenomenon is called delayed mutations. With genomic instability, the main cause of the formation of malignant tumors, the number of untargeted and delayed mutations sharply increases.
There are four possible genetic consequences of point mutations: 1) preservation of the meaning of the codon due to the degeneracy of the genetic code ( synonymous replacement nucleotide), 2) a change in the meaning of the codon, leading to the replacement of an amino acid in the corresponding place of the polypeptide chain (missense mutation), 3) the formation of a meaningless codon with premature termination (nonsense mutation). There are three meaningless codons in the genetic code: amber - UAG, ocher - UAA and opal - UGA (in accordance with this, mutations leading to the formation of meaningless triplets are also named - for example, amber mutation), 4) reverse substitution (stop codon to sense codon).
Based on their effect on gene expression, mutations are divided into two categories: mutations such as base pair substitutions and
type of reading frame shift (frameshift). The latter are deletions or insertions of nucleotides, the number of which is not a multiple of three, which is associated with the triplet nature of the genetic code.
A primary mutation is sometimes called a direct mutation, and a mutation that restores the original structure of a gene is called a reverse mutation, or reversion. A return to the original phenotype in a mutant organism due to restoration of the function of the mutant gene often occurs not due to true reversion, but due to a mutation in another part of the same gene or even another non-allelic gene. In this case, the recurrent mutation is called a suppressor mutation. The genetic mechanisms due to which the mutant phenotype is suppressed are very diverse.
Bud mutations (sports) are persistent somatic mutations occurring in the cells of plant growth points. Lead to clonal variability. They are preserved during vegetative propagation. Many varieties of cultivated plants are bud mutations.
Consequences of mutations for cells and organisms
Mutations that impair cell activity in a multicellular organism often lead to cell destruction (in particular, programmed cell death - apoptosis). If intra- and extracellular defense mechanisms did not recognize the mutation and the cell went through division, then the mutant gene will be passed on to all the descendants of the cell and, most often, leads to the fact that all these cells begin to function differently.
A mutation in a somatic cell of a complex multicellular organism can lead to malignant or benign neoplasms, a mutation in a germ cell leads to a change in the properties of the entire descendant organism.
In stable (unchanged or slightly changing) conditions of existence, most individuals have a genotype close to the optimal one, and mutations cause disruption of the body’s functions, reduce its fitness and can lead to the death of the individual. However, in very rare cases, a mutation can lead to the appearance of new useful signs, and then the consequences of the mutation are positive; in this case, they are a means of adapting the organism to the environment and, accordingly, are called adaptive.
The role of mutations in evolution
With a significant change in living conditions, those mutations that were previously harmful may turn out to be useful. Thus, mutations are material for natural selection. Thus, melanistic mutants (dark-colored individuals) in birch moth populations in England were first discovered by scientists among typical light-colored individuals in the middle of the 19th century. Dark coloring occurs as a result of a mutation in one gene. Butterflies spend the day on the trunks and branches of trees, usually covered with lichens, against which the light coloring acts as a camouflage. As a result of the industrial revolution, accompanied by air pollution, the lichens died and the light trunks of birches became covered with soot. As a result, by the middle of the 20th century (over 50-100 generations), in industrial areas the dark morph almost completely replaced the light one. It was shown that the main reason for the preferential survival of the black form was predation by birds, which selectively ate light-colored butterflies in polluted areas.
If a mutation affects “silent” sections of DNA, or leads to the replacement of one element of the genetic code with a synonymous one, then it usually does not manifest itself in the phenotype (the manifestation of such a synonymous substitution may be associated with different frequencies of codon use). However, such mutations can be detected using gene analysis methods. Since mutations most often occur as a result of natural causes, then, assuming that the basic properties external environment did not change, it turns out that the mutation rate should be approximately constant. This fact can be used to study phylogeny - the study of the origin and relationships of various taxa, including humans. Thus, mutations in silent genes serve as a “molecular clock” for researchers. The “molecular clock” theory also proceeds from the fact that most mutations are neutral, and the rate of their accumulation in a given gene does not depend or weakly depends on the action of natural selection and therefore remains constant for a long time. This rate will, however, differ for different genes.
The study of mutations in mitochondrial DNA (inherited on the maternal line) and in Y chromosomes (inherited on the paternal line) is widely used in evolutionary biology to study the origin of races, nationalities, and reconstruct the biological development of mankind.
The problem of random mutations
In the 40s, a popular point of view among microbiologists was that mutations are caused by exposure to an environmental factor (for example, an antibiotic), to which they allow adaptation. To test this hypothesis, a fluctuation test and a replica method were developed.
The Luria-Delbrück fluctuation test consists of dispersing small portions of the original bacterial culture into test tubes with a liquid medium, and after several cycles of division, an antibiotic is added to the test tubes. Then (without subsequent divisions) the surviving antibiotic-resistant bacteria are seeded onto Petri dishes with solid medium. The test showed that the number of resistant colonies from different tubes is very variable - in most cases it is small (or zero), and in some cases it is very high. This means that the mutations that caused resistance to the antibiotic arose at random points in time both before and after exposure to it.
VARIABILITY
Variability is the ability of living organisms to change, acquire new characteristics under the influence of external (non-hereditary variability) and internal (hereditary variability) environmental conditions.
Genotypic variability consists of MUTATIONAL AND COMBINATIVE variability.
IN the basis of hereditary variability lies sexual reproduction living organisms, which provides a huge variety of genotypes.
Combinative variability
The genotype of any individual is a combination of genes from the maternal and paternal organisms.
- independent segregation of homologous chromosomes in the first meiotic division.
- gene recombination (change in the composition of linkage groups) associated with crossing over.
- random combination of genes during fertilization.
Mutational variability
Mutation is an inherited change in the genotype that occurs under the influence of the external or internal environment.
The term was proposed by Hugo de Vries. The process of mutations is called mutagenesis. De Vries became convinced that new species do not arise through the gradual accumulation of continuous fluctuational changes, but through the sudden appearance sudden changes transforming one type into another.
Experiment
De Vries developed mutation theory based on observations of widespread weeds.
plant - biennial aspen, or evening primrose (Oenotherabiennis). De
Frieze collected seeds from a plant of a certain shape, sowed them and received 1...2% of plants of a different shape in the offspring.
It was later established that the appearance of rare variants of the trait in evening primrose is not a mutation; This effect is due to the peculiarities of the organization of the chromosomal apparatus of this plant. In addition, rare variants of traits may be due to rare combinations of alleles.
Mutations
Basic provisions of De Vries mutation theory
De Vries provisions |
Modern clarifications |
Mutations occur suddenly, without |
There is a special type of mutation |
any transitions. |
accumulating over a number of generations |
Success in identifying mutations |
without changes |
depends on the number |
|
analyzed individuals. |
|
Mutant forms are completely |
subject to 100% penetrance and 100% |
stable. |
expressiveness |
Mutations are characterized |
face mutations exist, as a result |
discreteness is qualitative |
of which little occurs |
changes that do not form |
change in characteristics |
continuous rows. |
|
The same mutations can |
this applies to gene mutations; chromosomal |
reoccur. |
aberrations are unique and inimitable |
Mutations can be harmful and |
mutations themselves are not adaptive |
useful. |
character; only in the course of evolution, in the course of |
selection is assessed by “utility”, |
|
“neutrality” or “harmfulness” of mutations in |
|
certain conditions; |
Mutants
An organism in which a mutation is detected in all cells is called a mutant. This occurs if the organism develops from
mutant cell (gametes, zygotes, spores).
In some cases, the mutation is not found in all somatic cells of the body; such an organism is called genetic mosaic. It happens,
if mutations appear during ontogenesis – individual development.
And finally, mutations can only occur in generative cells (in gametes, spores and in germinal cells - the precursor cells of spores and gametes). In the latter case, the organism is not a mutant, but some of its descendants will be mutants.
There are “new” mutations (arising de novo) and “old” mutations. Old mutations are mutations that appeared in the population long before they were studied; Old mutations are usually discussed in population genetics and evolutionary theory. New mutations are mutations that appear in the offspring of non-mutant organisms (♀ AA × ♂ AA → Aa); Usually it is precisely such mutations that are discussed in the genetics of mutagenesis.
Spontaneous and induced mutations
Spontaneous mutations occur spontaneously throughout the life of an organism in normal environmental conditions with a frequency of about 10-9 - 10-12 per nucleotide per cell generation.
Induced mutations are heritable changes in the genome that arise as a result of certain mutagenic effects in artificial (experimental) conditions or under adverse environmental influences.
Mutations appear constantly during processes occurring in a living cell. The main processes leading to mutations are DNA replication, DNA repair disorders, and transcription.
Induced mutations
Induced mutations arise under the influence mutagens.
Mutagens are a variety of factors that increase the frequency of mutations.
For the first time, induced mutations were obtained by domestic geneticists G.A. Nadson and G.S. Filippov in 1925 when irradiating yeast with radium radiation.
Classes of mutagens:
– Physical mutagens: ionizing radiation, thermal radiation, ultraviolet radiation.
– Chemical mutagens: nitrogen base analogues (e.g. 5-bromouracil), aldehydes, nitrites, ions heavy metals, some medications and plant protection products.
– Biological mutagens: pure DNA, viruses.
– Automutagens are intermediate metabolic products (intermediates). For example, ethanol itself is not a mutagen. However, in the human body it is oxidized to acetaldehyde, and this substance is already a mutagen.
Mutation classifications
genomic;
chromosomal;
Biology
9th grade
Teacher:
Ivanova Natalya Pavlovna
MKOU Dresvyanskaya secondary school
Lesson topic:
Patterns of variability:
mutational variability.
Mutations is a change in genotype that occurs under the influence of external or internal environmental factors.
Hugo (hugo) de Vries (February 16, 1848 G – May 21, 1935 G )
Introduced the modern, genetic concept of mutation to designate rare variants of traits in the offspring of parents who did not have this trait.
Basic provisions of mutation theory:
- Mutations occur suddenly, spasmodically.
- Mutations are inherited, that is, they are persistently transmitted from generation to generation.
Mutations are not directed: a gene can mutate at any locus, causing changes in both minor and vital signs.
- The same mutations can occur repeatedly.
- Mutations can be beneficial or harmful to the body, dominant or recessive.
According to the nature of the change in the genotype, mutations are divided into three groups:
- Genetic.
- Chromosomal.
- Genomic.
Gene, or point, mutations.
They occur when one or more nucleotides within one gene are replaced by others.
Dropout of bases
ACCTGCGTGCCAAATGTGTGC
Replacing bases.
ACCTGCGTGCCAAATGTGTGC
Thr-Cys-Val-Pro-Tyr-Val-Cys
Thr-Cys-Val-Pro-Tyr-Val-Cys
ACCTGCGT GTGTGC
ACCTG A GTGCCAAATGTGTGC
Thr-Cys-Val- Cys-Val
Thr- STOP - Val-Pro-Tyr-Val-Cys
Adding bases
ACCTGCGTGCCAAATGTGTGC
Thr-Cys-Val-Pro-Tyr-Val-Cys
ACCTGCGTGCCAGTACAATGTGTGC
Thr-Cys-Val-Pro- Phe-Gln-Cys-Val
valine). This leads to the fact that in the blood red blood cells with such hemoglobin are deformed (from round to sickle-shaped) and quickly destroyed. At the same time, it develops acute anemia and there is a decrease in the amount of oxygen carried by the blood. Anemia causes physical weakness, problems with the heart and kidneys, and can lead to early death in people homozygous for the mutant allele. "width="640" Sickle cell anemia
The recessive allele, which causes this hereditary disease in the homozygous state, is expressed in the replacement of just one amino acid residue in ( B - chains of the hemoglobin molecule ( glutamic acid-" - valine). This leads to the fact that in the blood red blood cells with such hemoglobin are deformed (from round to sickle-shaped) and quickly destroyed. In this case, acute anemia develops and a decrease in the amount of oxygen carried by the blood is observed. Anemia causes physical weakness, problems with the heart and kidneys, and can lead to early death in people homozygous for the mutant allele.
Chromosomal mutations.
Significant changes in chromosome structure affecting several genes.
Types of chromosomal mutations:
A B IN G D E AND Z – normal chromosome.
A B IN G D E AND - loss (loss of end part
chromosomes)
A B IN D E AND Z – deletion (loss of internal
chromosome region)
A B IN G D E G D E AND Z – duplication (doubling some
any part of the chromosome)
A B IN G AND E D Z – inversion (rotate the area inside
chromosomes at 180˚)
Cry of the Cat Syndrome (chromosomal disease)
Reduction of one arm of chromosome 5.
- Characteristic crying, reminiscent of a cat's cry.
- Profound mental retardation.
- Multiple anomalies of internal organs.
- Stunted growth.
Genomic mutations.
They usually arise during meiosis and lead to the acquisition or loss of individual chromosomes (aneuploidy) or haploid sets of chromosomes (polyploidy).
Examples of aneuploidy are:
- Monosomy, general formula 2n-1 (45, XO), disease – Shereshevsky-Turner syndrome.
- Trisomy, general formula 2n+1 (47, XXX or 47, XXY), disease - Klinefelter syndrome.
Down syndrome.
Trisomy on chromosome 21.
Mental and physical retardation.
Half-open mouth.
Mongoloid face type. Slanted eyes. Wide bridge of nose.
Heart defects.
Life expectancy decreases by 5-10 times
Patau syndrome.
Trisomy 13
Microcephaly (shrinkage of the brain).
Low sloping forehead, narrowed palpebral fissures.
Cleft upper lip and palate.
Polydactyly.
High mortality (90% of patients do not survive to 1 year).
Factors that cause mutations are called mutagenic.
Mutagenic factors include:
1) Physical (radiation, temperature, electromagnetic radiation).
2) Chemicals (substances that cause poisoning of the body: alcohol, nicotine, colchicine, formaldehyde).
3) Biological (viruses, bacteria).
The meaning of mutations
Mutations can be beneficial, harmful or neutral.
- Beneficial Mutations: mutations that lead to increased resistance of the body (resistance of cockroaches to pesticides).
- Harmful mutations: deafness, color blindness.
- Neutral mutations: mutations do not affect the viability of the organism in any way (eye color, blood type).
Homework:
- Section 3.12 of the textbook.
- Questions, page 122.
- Message on the topic “Shereshevsky-Turner syndrome”.
1 slide
2 slide
Variability is a universal property of living organisms to acquire new characteristics under the influence of the environment (both external and internal).
3 slide
4 slide
Non-hereditary variability Phenotypic variability (modification) is a change in organisms under the influence of environmental factors and these changes are not inherited. This variability does not affect the genes of the organism; the hereditary material does not change. The modification variability of a trait can be very large, but it is always controlled by the genotype of the organism. The boundaries of phenotypic variability controlled by the genotype of the organism are called the reaction norm.
5 slide
Reaction norm Some traits have a very broad reaction norm (for example, wool shearing from sheep, milk production from cows), while other traits are characterized by a narrow reaction norm (coat color in rabbits). A wide reaction rate leads to increased survival. The intensity of modification variability can be adjusted. Modification variability is directed.
6 slide
Variation series of trait variability and variation curve Variation series represents a series of variants (there are values of the trait) arranged in descending or ascending order (for example: if you collect leaves from the same tree and arrange them as the length of the leaf blade increases, you get a variation series variability of this trait). The variation curve is graphic image the relationship between the range of variability of a trait and the frequency of occurrence of individual variants of this trait. The most typical indicator of a trait is its average value, that is, the arithmetic mean of the variation series.
7 slide
Types of phenotypic variability Modifications are non-hereditary changes in the genotype that occur under the influence of environmental factors, are adaptive in nature and are most often reversible (for example: an increase in red blood cells in the blood with a lack of oxygen). Morphoses are non-hereditary changes in phenotype that arise under the influence of extreme factors environments, are not adaptive in nature and are irreversible (for example: burns, scars). Phenocopies are a non-hereditary change in the genotype that resembles hereditary diseases (enlargement of the thyroid gland in areas where there is not enough iodine in the water or soil).
8 slide
Hereditary variability Hereditary changes are caused by changes in genes and chromosomes, are inherited, vary among individuals within the same species, and persist throughout the life of the individual.
Slide 9
Combinative hereditary variability Combinative is called variability, which is based on the formation of recombinations, i.e., such combinations of genes that the parents did not have. The basis of combinative variability is the sexual reproduction of organisms, as a result of which a huge variety of genotypes arises. Three processes serve as practically unlimited sources of genetic variability: Independent segregation of homologous chromosomes in the first meiotic division. It is the independent combination of chromosomes during meiosis that is the basis of Mendel's third law. The appearance of green smooth and yellow wrinkled pea seeds in the second generation from crossing plants with yellow smooth and green wrinkled seeds is an example of combinative variability. Mutual exchange of sections of homologous chromosomes, or crossing over. It creates new clutch groups, i.e. it serves important source genetic recombination of alleles. Recombinant chromosomes, once in the zygote, contribute to the appearance of characteristics that are atypical for each of the parents. Random combination of gametes during fertilization.
10 slide
Mutation hereditary variability Mutation is the variability of the genotype itself. Mutations are sudden, inherited changes in genetic material that lead to changes in certain characteristics of the organism.
11 slide
The main provisions of the mutation theory of G. De Vries Mutations arise suddenly, spasmodically, as discrete changes in characteristics. Unlike non-hereditary changes, mutations are qualitative changes that are passed on from generation to generation. Mutations manifest themselves in different ways and can be both beneficial and harmful, both dominant and recessive. The probability of detecting mutations depends on the number of individuals examined. Similar mutations may occur repeatedly. Mutations are undirected (spontaneous), i.e., any part of the chromosome can mutate, causing changes in both minor and vital signs.
12 slide
Classification of mutations Types of mutations by change in genotype Change of one gene Change in the structure of chromosomes Change in the number of chromosomes Loss of a part of a chromosome, rotation or doubling of a chromosome section Replacement, loss or doubling of nucleotides Multiple increase in the number of chromosomes; decrease or increase in the number of chromosomes
Slide 13
Gene mutations There are different types of gene mutations associated with the addition, deletion, or rearrangement of nucleotides in a gene. These are duplications (repetition of a gene section), insertions (the appearance of an extra pair of nucleotides in the sequence), deletions (the loss of one or more nucleotide pairs), substitutions of nucleotide pairs, inversions (turning a gene section by 180°). The effects of gene mutations are extremely diverse. Most of of these is not phenotypically manifested because they are recessive. This is very important for the existence of the species, since most newly occurring mutations are harmful. However, their recessive nature allows them long time persist in individuals of a species heterozygous state without harm to the body and appear in the future upon transition to a homozygous state.
Slide 14
Gene mutations At the same time, there are a number of cases where a change in only one base in a certain gene has a noticeable effect on the phenotype. One example is the genetic abnormality of sickle cell anemia. The recessive allele, which causes this hereditary disease in the homozygous state, is expressed in the replacement of just one amino acid residue in the B-chain of the hemoglobin molecule (glutamic acid -> valine). This leads to the fact that in the blood red blood cells with such hemoglobin are deformed (from rounded ones become sickle-shaped) and quickly collapse. At the same time, acute anemia develops and a decrease in the amount of oxygen carried by the blood is observed. Anemia causes physical weakness, disturbances in the functioning of the heart and kidneys, and can lead to early death in people homozygous for the mutant allele.
15 slide
Chromosomal mutations Known rearrangements different types: deficiency, or deficiency, - loss of the terminal sections of a chromosome; deletion - loss of a section of a chromosome in its middle part; duplication - two-or repetition genes localized in a specific region of the chromosome; inversion - rotation of a section of a chromosome by 180°, as a result of which genes in this section are located in the reverse sequence compared to the usual one; translocation is a change in the position of any part of a chromosome in the chromosome set. The most common type of translocations are reciprocal, in which regions are exchanged between two non-homologous chromosomes. A section of a chromosome can change its position without reciprocal exchange, remaining in the same chromosome or being included in some other one.
16 slide
With deficiencies, deletions and duplications, the amount of genetic material changes. The degree of phenotypic change depends on how large the corresponding chromosome regions are and whether they contain important genes. Examples of deficiencies are known in many organisms, including humans. A severe hereditary disease, “cry of the cat” syndrome (named after the nature of the sounds made by sick babies), is caused by heterozygosity for deficiency in the 5th chromosome. This syndrome is accompanied by severe growth impairment and mental retardation. Children with this syndrome usually die early, but some survive into adulthood.
Slide 17
Genomic mutations This is a change in the number of chromosomes in the genome of the body's cells. This phenomenon occurs in two directions: towards an increase in the number of entire haploid sets (polyploidy) and towards the loss or inclusion of individual chromosomes (aneuploidy).
18 slide
Polyploidy This is a multiple increase in the haploid number of chromosomes. Cells with different numbers haploid sets of chromosomes are called triploid (Зn), tetraploid (4n), hexanloid (6n), octaploid (8n), etc. Most often, polyploids are formed when the order of chromosome divergence to the cell poles is disrupted during meiosis or mitosis. This can be caused by physical and chemical factors. Chemical substances such as colchicine suppress the formation of the mitotic spindle in cells that have begun to divide, as a result of which the doubled chromosomes do not diverge and the cell turns out to be tetraploid. Polyploidy results in changes in the characteristics of an organism and is therefore an important source of variation in evolution and selection, especially in plants. This is due to the fact that hermaphroditism (self-pollination), apomixis (parthenogenesis) and vegetative propagation. Therefore, about a third of the plant species common on our planet are polyploids, and in the sharply continental conditions of the high-mountain Pamirs, up to 85% of polyploids grow. Almost all cultivated plants are also polyploids, which, unlike their wild relatives, have larger flowers, fruits and seeds, and more accumulate in storage organs (stems, tubers). nutrients. Polyploids adapt more easily to unfavorable living conditions and tolerate low temperatures and drought. That is why they are widespread in the northern and high mountain regions. The basis for the sharp increase in the productivity of polyploid forms of cultivated plants is the phenomenon of polymerization.
Slide 19
Aneuploidy or heteroploidy is a phenomenon in which the cells of the body contain an altered number of chromosomes that is not a multiple of the haploid set. Aneuploids arise when individual homologous chromosomes do not separate or are lost during mitosis and meiosis. As a result of nondisjunction of chromosomes during gametogenesis, germ cells with extra chromosomes can arise, and then, upon subsequent fusion with normal haploid gametes, they form a zygote 2n + 1 (trisomic) on a specific chromosome. If there is one less chromosome in the gamete, then subsequent fertilization leads to the formation of a zygote 1n - 1 (monosomic) on any of the chromosomes. In addition, there are forms 2n - 2, or nullisomics, since there is no pair of homologous chromosomes, and 2n + x, or polysomics.
20 slide
Aneuploids are found in plants and animals, as well as in humans. Aneuploid plants have low viability and fertility, and in humans this phenomenon often leads to infertility and in these cases is not inherited. In children born to mothers over 38 years of age, the likelihood of aneuploidy is increased (up to 2.5%). In addition, cases of aneuploidy in humans cause chromosomal diseases. In dioecious animals, both in natural and in artificial conditions Polyploidy is extremely rare. This is due to the fact that polyploidy, causing a change in the ratio of sex chromosomes and autosomes, leads to disruption of the conjugation of homologous chromosomes and thereby complicates sex determination. As a result, such forms turn out to be sterile and less viable.
Slide 23
The law of homological series in hereditary variability The largest generalization of work on the study of variability at the beginning of the 20th century. became the law of homological series in hereditary variability. It was formulated by the outstanding Russian scientist N.I. Vavilov in 1920. The essence of the law is as follows: species and genera that are genetically close, related to each other by a unity of origin, are characterized by similar series of hereditary variability. Knowing what forms of variability occur in one species, one can predict the presence of similar forms in a related species. Thus, similar mutations occur in different classes of vertebrates: albinism and absence of feathers in birds, albinism and hairlessness in mammals, hemophilia in many mammals and humans. In plants, hereditary variability is noted for such characteristics as filmy or bare grains, awned or awnless ears, etc. Medical science It became possible to use animals with homologous diseases as models for studying human diseases: this diabetes rats; congenital deafness of mice, dogs, guinea pigs; cataracts of the eyes of mice, rats, dogs, etc.
24 slide
Cytoplasmic heredity The leading role in genetic processes belongs to the nucleus and chromosomes. At the same time, some organelles of the cytoplasm (mitochondria and plastids), which contain their own DNA, are also carriers of hereditary information. Such information is transmitted with the cytoplasm, which is why it is called cytoplasmic heredity. Moreover, this information is transmitted only through the mother’s body, and therefore is also called maternal. This is due to the fact that in both plants and animals the egg contains a lot of cytoplasm, while the sperm is almost devoid of it. Due to the presence of DNA not only in the nuclei, but also in the organelles of the cytoplasm, living organisms receive a certain advantage in the process of evolution. The fact is that the nucleus and chromosomes are distinguished by genetically determined high resistance to changing environmental conditions. At the same time, chloroplasts and mitochondria develop to some extent independently of cell division, directly responding to environmental influences. Thus, they have the potential to ensure rapid reactions of the body to changes in external conditions.
Biology 10th grade
Topic: “Mutations. Types of mutations"
Lesson objectives:
Educational: studying the types of mutations and the causes of their occurrence
Developmental : development of supra-subject and intra-subject competencies, formation of a scientific picture of the world.
Educational : fostering conscious responsibility for one’s health and the health of others;ability to organize business cooperation and mutual control in pairs; develop reflection skills
Lesson type: learning new material
Methods:
Methods of developing interest in learning (story, methods of emotional stimulation)
Methods of organizing and implementing educational activities and operations (story, conversation, demonstrations, completing tasks);
Methods of self-management of educational activities ( independent work);
Methods of control and self-control (work with cards, with a book (independent work), conversation, use of elements of problem-based learning, oral questioning, work at the board, use of gaming technology).
EQUIPMENT: TCO, presentation,
During the classes:
Organizing time.
Teacher: good afternoon, guys!
What topic did you study in the last lesson?
What is variability? Let's test your knowledge on the topic: Variability. To do this, I suggest you fill out the diagram in your notebooks.
Learning new material .
We will start today's lesson with the famous poem by A. Pushkin:
Oh how many wonderful discoveries we have1 slide
The spirit prepares for enlightenment,
And experience, the son of difficult mistakes,
And genius, friend of paradoxes,
And chance, God the inventor...
Please tell me: are these words true for biology? (there are many discoveries). Are there paradoxes in biology? At what level can they be noticed? And maybe there is a chance to invent something?
Pay attention to the slides:
2 slide
Guys, please tell me, did you see some kind of paradox here? Something unusual? (possible answers: an unusual white lion, a two-headed snake, a completely ordinary butterfly and plants - a paradox: “normal” organisms and “abnormal” ones).
Indeed, it is rare in nature to see a two-headed snake or a white lion - this is a paradox. Can you guess what is the reason for the appearance of these paradoxical, unusual organisms? (possible answer: presence of changes in the body)
(Where did the changes occur?), mutations (What are mutations?)). All these organisms are a consequence of changes in the body, in genes and chromosomes.
The topic of our lesson is “Mutations: paradox or pattern?”SLIDE 3. .
Today in class we will look at the types of mutations, find outWhat mutations occur in the human body, what diseases does it lead to?
Mutation from Latin "mytatio" - change. These are qualitative and quantitative changes in the DNA of organisms, leading to changes in the genotype. (slide 4 and entry in the work card).
The term was introduced by Hugo de Vries in 1901.
What consequences can mutations lead to? Is it always illnesses and physical deformities? (return to the slide, note that the butterfly and plants also have changes in the body - mutations) -slide 5
(possible answer: mutations do not always manifest themselves phenotypically). They affect DNA to varying degrees: a single gene, a single chromosome, or the entire genotype. According to the level of occurrence of mutations, they are divided into groups: (worksheet with a diagram, students fill out a work card as they study). Slide 5
mutations
Gene mutations: slide 6 (working with the textbook): Changes in one or more nucleotides within a gene, they are often called point ones. They arise during DNA replication, instead of complementary steam A-T and G-C, incorrect combinations occur, resulting in new combinations of nucleotides that encode new or changed proteins. Such seemingly minor changes lead to serious, incurable diseases. Color blindness, hemophilia, lack of pigmentation - all these are gene mutations. (slides 7,8,9)
slide 9. The hemophilia gene is X-linked, so he received it from his mother. The prince's grandmother Alice was a carrier of the mutant gene, which she in turn received from her mother, Queen Victoria. And Queen Victoria inherited it from one of her ancestors, but since her husband Prince Albert was her cousin, then it is quite possible that their daughters received a defective X chromosome from either dad or mom. All of them were carriers of the mutant gene. It was from them that hemophilia began to roam around the royal and royal families Europe. One son, three grandsons and four (and according to other sources - 6) great-grandsons of Queen Victoria suffered from hemophilia.
Chromosomal mutations: ( significant changes in chromosome structure affect several genes. Depending on the changes, they are divided into groups: (working with the textbook)
A) loss - separation of the terminal part of a chromosome (chromosomal mutation in human chromosome 21 causes acute leukemia and leads to death).
B) deletion – loss of the middle part (severe illness, death)
C) duplication - doubling of any section
D) inversion - chromosome break in 2 places, rotation of the resulting fragment by 180° and reverse insertion at the break site.
Chromosomal mutations: naturally lead to the death of organisms, as they affect entire chromosomes (organisms are not viable: mutation of human chromosome 21 leads to severe leukemia and death.)
Paradox: viruses (bacteriophages) can lose a significant part of their only chromosome and replace it with foreign DNA. At the same time, they not only retain their functional activity, but also acquire new properties. It is possible that diseases such as avian and swine flu– a consequence of chromosomal mutations of viruses.
Genomic mutations: change in the number of chromosomes (slide 14)
A) not a multiple of the haploid set (± 1 chromosome) - heteroploidy - Down syndrome(“sunny children”) Shereshevsky – Turner (slide 14)
B) a multiple of the haploid set (an increase in the number of chromosomes by 2, 4 or more times) – polyploidy. It is characteristic of plants, leading to an increase in mass and yield. It is obtained artificially by exposing the cell to colchicine (destroys the spindle). (slide polyploid plants –15)
Because this type mutations lead to changes in the number of chromosomes,
Slide 17.find and underline 1-2 facts confirming that:
The first row - the causes of mutations may be the lifestyle of the parents.
Second row - the causes of mutations may be environmental pollution.
Third row - the consequences of mutations are diseases.
Mutagens and their effects on the body.
High mutagenic activity was found in smokedsteaks, overcooked meat, black pepper, vanillin, fat that is repeatedly used for frying, alcohol, tobacco smoke substances.Some birth defects development can be caused by various non-hereditary factors (rubella virus, medications, dietary supplements ), disrupting embryogenesis. If during pregnancy the mother did not receive enough zinc in her diet, found mainly in meat, the child will later have difficulty learning to read.
Mutations that occurin somatic cells of the body, cause premature aging, shorten the lifespanlife,this is the first step towards the formation of malignant tumors. The vast majority of all cases of breast cancer arethe result of somatic mutations.
After the accident at the Chernobyl nuclear power plantas a result of radiation exposure, the incidence of cancerthyroid gland in the Gomel region increased 20 times. ExcessNew ultraviolet radiation increases the risk of cancerskin.
IN tobacco smoke contains more than 4 thousand.chemical compounds, of whichabout 40 are classified as carcinogens,and 10 actively contribute to the developmentcancer diseases.With solid components more or lesscigarettes cope with it successfullyfilters, but from carbon monoxide and carbonliquefied gas, ammonium, cyanideth hydrogen, gasoline and other harmful substances in gaseousFilters don't help when standing.
Generative mutations i.e., violations of the DNA structure in polocells, can lead to spontaneous abortions (miscarriages),stillbirth and increasedfrequency of hereditary diseasesvaniya.
After the Chernobyl disasterroefs in areas affectedmaximum pollutiondionuclides, almost 2 times morethe frequency of child births was determinedwith developmental anomalies (cleftswe lips and palate, doubling of the kidneysand ureters, polydactyly, developmental disorders of the brainbrain, etc.).
Vitamins, sulfur-containing amino acids, vegetable and fruit juices (cabbage, apple, mint, pineapple) have a pronounced antimutagenic effect. What conclusions can be drawn from these data for healthy image life?
Slide 18.What violations did you find in the pictures below? (On the left are three X chromosomes, on the right are XXY).
In which chromosomes did the mutations occur? (In the genitals). What is this type of mutation called? (Sex chromosome trisomy). Klinefelter syndrome, Shereshevsky-Turner syndrome).
Women with the XXX set do not have any significant pathologies. A man with a set of XXY suffers from Klinefelter's disease. (The reproductive system is underdeveloped, height is high, intelligence is reduced, effeminate structure). If one sex X chromosome is missing in a woman’s body, a girl with Shereshevsky-Turner syndrome develops. (Infertility, short stature, short neck).
III .Reinforcement.
Game "Loto". (Mosaic)
Blue color – gene mutations
Change in the number of chromosomes
The new organism is reproductively isolated, which leads to a natural evolutionary process - speciation.
Ath
slide 20. correct mosaic.
Now let’s return to the first slide and the organism presented - a two-headed snake, we often call such organisms “mutant”. Tell me, what type of mutation is this? The paradox is that from the standpoint of genetics, this organism cannot be called a mutant, since the changes here are not at the DNA level, but at the embryo level (the process of fragmentation of the zygote is disrupted). This is a “mutant snake”, but without mutations.
And in conclusion, let us once again turn to Pushkin’s lines: are there paradoxes in biology? (Yes, we were convinced during the lesson), can you, with an example from today’s lesson, confirm the line “the chance of God being the inventor” - (random mutations lead to speciation). The diversity of species is a natural evolutionary process, which occurs largely due to mutations, but as a result of natural selection, only useful mutations are preserved.
So, is mutation a paradox or a pattern? On the one hand, these are natural changes under the influence of environmental factors, on the other hand, this is a paradox, since new species appear and completely unusual organisms survive.
Appearing suddenly, mutations, like revolutions, destroy and create, but do not destroy the laws of nature. They themselves are subject to them.
Reflection.
Medical genetics doesn't know everything yet. On the path from genes to traits, there are many unknowns and unexpected things hidden.Perhaps some of you will make new discoveries on the path of prevention hereditary diseases person. But this is the topic of the next lesson. Thank you for the lesson. Goodbye. And remember the wise words of your grandmother: “The main thing is health.”
IV .Homework.
Summarizing. Grading.
Test Verification work on the topic: "Types of mutations"
Option 1.
1. Mutations leading to a change in the number of chromosomes:
2.Doubling of a chromosome section is called:
a) duplication; b) deletion; c) inversion.
3. Multiple changes in the number of chromosomes:
a) polyploidy; b) aneuploidy; c) allopolyploidy.
4. The occurrence of chromosomal mutations is associated with:
b) with chromosome breakage and reunification in new combinations;
c) with a change in the sequence of DNA nucleotides.
5. The cause of Down syndrome is a mutation:
a) genetic; b) chromosomal; c) genomic.
Test work on the topic; "Types of mutations."
Option 2.
1. Mutations associated with changes in the sequence of DNA nucleotides:
a) chromosomal; b) genomic; c) genetic.
2. Multiple number of chromosomes:
a) polyploidy; b) aneuploidy (heteroploidy);
c) autopolyploidy.
3. Lack of a chromosome section:
a) inversion; b) duplication; c) deletion.
4. Down syndrome is a manifestation of a mutation:
a) genomic; b) chromosomal; c) genetic.
5.The occurrence of genomic mutations is associated with:
a) with a violation of mitosis or meiosis;
b) with a change in the sequence of nucleotides in DNA;
c) with chromosome breakage and reunification in new combinations.
Work card.
10th grade student(s) _____________________________________________________
Vocabulary work:
Paradox - situation ( , , formation Lesson topic “……………………………………………………………”
Qualitative and quantitative changes in the DNA of organisms that lead to changes in the genotype are called _______________________.
Term introduced ______________________________________________________________
Types of mutations
Mutagenic factors: Properties of mutations:
Game "Loto". (Mosaic)
We glue colored cards to each cell. We determine what type of mutation each given trait belongs to.
Green color– gene mutations
Red color – genomic mutations
Yellow– chromosomal mutations
Changes in the shape and size of chromosomes
Change of one or more nucleotides within a gene
Down syndrome, Shereshevsky–Turner syndrome
Colorblindness, hemophilia, lack of pigmentation
Change in the number of chromosomes
They arise during DNA replication
The new organism is reproductively isolated, which leads to a natural evolutionary process - speciation.
Ath Without 1 amino acid in the hemoglobin molecule, a serious disease occurs - sickle cell anemia
Depending on the changes, they are divided into groups: loss, deletion, duplication.
Test work
Loading...